Want to know:
Which measure would be considered a form of primary prevention for suicide?a. Psychiatric hospitalization of a suicidal patientb. Referral of a formerly suicidal patient to a support groupc. Suicide precautions for 24 hours for newly admitted patientsd. Helping school children learn to manage stress and be resilient
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Spark.E adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- In the following DNA molecule, how many 3' hydroxyls are present?AATAGCGGATGCCCGAATACGAGTTATCGCCTACGGGCTTATGCTC
- what did pythagoreans answer the questions: What is the nature of ultimate reality?
- A term referring to the range of tasks that a child cannot yet master alone, but that she or he can accomplish with the guidance of a more capable partner is called