Back to Questions
Want to know:
9.3 A dot plot provides a straightforward way to identifysimilar regions in pairs of sequences. In a dot plot, onesequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Yaxis. A dot is placed in the plot whenever the nucleotidein a column on the X-axis matches the nucleotide in a row on the Y-axis.a. Construct a dot plot for each of the following pairs ofsequences, and then state where the plot reveals regionsof similarity between each pair of sequences.i. GCATTTAGAGCCCTAGTCGTGACAGATTCAGTTAGAGCCCTAGCTGATTGCii. AGCGATTGGTCCTGTACGAGCTAAGATGCACCTGTACGAGCCTTAb. Consider the results of your dot plots. What are someof the issues that the BLAST program, which performssequence similarity searches between a querysequence and sequences in a database, must address?
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Spark.E adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- A researcher interested in the control of the cell cycle identifies a yeast mutant (cd-) whose rate of cell division is temperature sensitive. At low, permissive temperatures, the mutant strain grows normally and produces yeast colonies having a normal size. However, at elevated, restrictive temperatures, the mutant strain is unable to divide and produces no colonies. She has a yeast genomic library made in a plasmid vector (containing the ura3+ selectable marker) and a ura3- cd- mutant, and she wants to clone the gene affected in the cell division mutant.What steps should she take to accomplish this objective?
- Why should nucleases be avoided in nucleic acid extractions?a. it can degrade the nucleic acidsb. the downstream molecular biology reactions will failc. the nucleic acid quality will be lowd. all of these
- You just sequenced a single genome sample using Illumina and you received two files with your data from the sequencing core. Was the sequencing mostly likely single-end or paired-end?